Working...
ClinicalTrials.gov
ClinicalTrials.gov Menu

Clinical, Psychological and Genetic Characteristics in Dermatological Patients

The safety and scientific validity of this study is the responsibility of the study sponsor and investigators. Listing a study does not mean it has been evaluated by the U.S. Federal Government. Know the risks and potential benefits of clinical studies and talk to your health care provider before participating. Read our disclaimer for details.
ClinicalTrials.gov Identifier: NCT03831646
Recruitment Status : Recruiting
First Posted : February 6, 2019
Last Update Posted : February 6, 2019
Sponsor:
Collaborators:
Ariel University
Tirat Carmel Mental Health Center
Medical Centre Hospital of the President’s Affairs Administration, Republic of Kazakhstan
Information provided by (Responsible Party):
Tatyana Vinnik, Astana Medical University

Brief Summary:

Atopic dermatitis (AD) and psoriasis (PS) are chronic, relapsing dermatological disorders with a high rate of psychiatric co-morbid pathology represented with depression. Brain Derived Neurotrophic Factor (BDNF) belongs to the neurotrophin family and widely studied in pathophysiology of psychiatric and dermatological disorders. A biological stress response system by altered hypothalamic-pituitary-adrenal (HPA) axis as well hypothalamic-pituitary-gonadal (HPG) axis may contribute to dermatoses and psychiatric disorders development. Various factors including gender, genetic, psychological stress, socioeconomic factors also affect the course of dermatoses.

A 10-week, case-control study evaluate clinical, psychological and biochemical parameters in AD and PS patients, and healthy control volunteers (HC) depending on gender and BDNF rs6265 gene polymorphism. All parameters are evaluated twice: at disease exacerbation (study baseline) and week 10.

The following methods are conducted: assessment of dermatological status, using Scoring of Atopic Dermatitis (SCORAD) and Psoriasis Area and Severity Index (PASI); assessment of depression and anxiety according to DSM-V criteria and with Hamilton Depression Rating Scale (HAM-D) and with Hamilton Anxiety Rating Scale (HAM-A); analysis of serum BDNF (ng/ml), cortisol (nmol/L), testosterone (ng/dL) and IgE levels (IU/ml, AD only); DNA extraction and genotyping of BDNF variants.The study will last during 4-5 months.


Condition or disease
Atopic Dermatitis Psoriasis

  Show Detailed Description

Layout table for study information
Study Type : Observational
Estimated Enrollment : 150 participants
Observational Model: Case-Control
Time Perspective: Prospective
Official Title: Clinical, Psychological and Genetic Characteristics of Patients With Atopic Dermatitis and Psoriasis
Actual Study Start Date : January 20, 2019
Estimated Primary Completion Date : May 20, 2019
Estimated Study Completion Date : June 10, 2019

Resource links provided by the National Library of Medicine

MedlinePlus related topics: Eczema Psoriasis

Group/Cohort
dermatological patients
atopic dermatitis and psoriasis patients with mild and moderate severity of dermatoses in the stage of exacerbation



Primary Outcome Measures :
  1. Assessment of change in the severity of atopic dermatitis after conventional treatment from study onset (baseline) at week 10 [ Time Frame: At disease onset (study baseline) and at week 10 ]
    Assessment of atopic dermatitis severity is conducted using Scoring of Atopic Dermatitis (SCORAD) index. SCORAD index formula is: A/5 + 7B/2 + C. In this formula A is defined as the extent (0-100), B is defined as the intensity (0-18) and C is defined as the subjective symptoms (0-20). The maximum SCORAD score is 103. SCORAD <23 - mild AD; SCORAD from 23 to 63 - moderate AD; SCORAD> 63 - severe AD.

  2. Assessment of change in the severity of psoriasis after conventional treatment from study onset (baseline) at week 10 [ Time Frame: At disease onset (study baseline) and at week 10 ]
    Assessment of the psoriasis severity is conducted using Psoriasis Area and Severity Index (PASI). The patient's body is divided into four sections (head (H) (10% of a person's skin); arms (A) (20%); trunk (T) (30%); legs (L) (40%)). The percent of skin lesions of each area is assessed as follows: 0 (0% of involved area); 1 (< 10%); 2 (10-29%); 3 (30-49%); 4 (50-69%); 5 (70-89%); 6 (90-100%). Further, for each region, the intensity of 3 clinical signs is evaluated - redness, thickness and scaling and assessed as follows: 0 - no lesions,1 - easy, 2 - moderate, 3 - severe, 4 - very severe. The sum of all three severity parameters is calculated for each section, multiplied by the area score for that area and multiplied by weight of respective section (0.1 for head, 0.2 for arms, 0.3 for body, 0.4 for legs). PASI range is from 0 (no disease) to 72 (maximum disease). The severity of psoriasis is assessed as follows: PASI <20 - mild; PASI from 20 to 50 - moderate; PASI> 50 - severe

  3. Assessment of change in the severity of depression in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10 [ Time Frame: At disease onset (study baseline) and week 10 ]
    Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

  4. Assessment of the severity of depression in healthy controls (HC) [ Time Frame: At disease onset (study baseline) ]
    Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

  5. Assessment of change in the severity of anxiety in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10 [ Time Frame: At disease onset (study baseline) and week 10 ]
    Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

  6. Assessment of the severity of anxiety in HC [ Time Frame: At disease onset (study baseline) ]
    Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

  7. Evaluation of changes in serum immunoglobulin E (IgE, IU/ml) levels from study onset (baseline) at week 10 in atopic dermatitis patients [ Time Frame: At disease onset (study baseline) and week 10 ]
    The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

  8. Analysis of serum IgE (IU/ml) levels in HC [ Time Frame: At disease onset (study baseline) ]
    The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

  9. Evaluation of changes in serum Brain Derived Neurotrophic Factor (BDNF, ng/ml) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients [ Time Frame: At disease onset (study baseline) and week 10 ]
    Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

  10. Analysis of serum BDNF (ng/ml) levels in HC [ Time Frame: At disease onset (study baseline) ]
    Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

  11. Evaluation of changes in cortisol (nmol/L) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients [ Time Frame: At disease onset (study baseline) and week 10 ]
    The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

  12. Analysis of serum cortisol (nmol/L) levels in HC [ Time Frame: At disease onset (study baseline) ]
    The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

  13. Evaluation of changes in testosterone (ng/dL) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients [ Time Frame: At disease onset (study baseline) and week 10 ]
    The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

  14. Analysis of serum testosterone (ng/dL) levels in HC [ Time Frame: At disease onset (study baseline) ]
    The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

  15. DNA extraction in AD, PS and HC [ Time Frame: At disease onset (study baseline) ]
    DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC


Secondary Outcome Measures :
  1. Assessment and comparison (Unpaired t-test) of SCORAD scores in extrinsic atopic dermatitis (EAD, IgE level above the normal) and intrinsic atopic dermatitis (IAD, normal IgE level) patients compared with baseline after conventional treatment at week 10 [ Time Frame: At disease onset (study baseline) and week 10 ]
    EAD and IAD patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of SCORAD scores compared with baseline after conventional treatment at week 10 in each group using unpaired t-test

  2. Assessment and comparison (Unpaired t-test) of PASI scores in psoriasis patients compared with baseline after conventional treatment at week 10 in accordance with BDNF gene polymorphism (Val/Val; Val/Met;Met/Met) and gender(males, females) [ Time Frame: At disease onset (study baseline) and week 10 ]
    Psoriasis patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of PASI scores compared with baseline after conventional treatment at week 10 in each group.

  3. Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-D scores in EAD, IAD, PS and HC [ Time Frame: At disease onset (study baseline) and week 10 ]
    Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-D scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-D scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

  4. Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-A scores in EAD, IAD,PS and HC [ Time Frame: At disease onset (study baseline) and week 10 ]
    Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-A scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-A scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

  5. Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum BDNF (ng/ml) levels in EAD, IAD,PS and HC [ Time Frame: At disease onset (study baseline) and at week 10 ]
    Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum BDNF(ng/ml) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum BDNF levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

  6. Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum cortisol (nmol/L) levels in EAD, IAD,PS and HC [ Time Frame: At disease onset (study baseline) and at week 10 ]
    Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for comparisons of serum cortisol (nmol/L) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum cortisol levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

  7. Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD,PS and HC [ Time Frame: At disease onset (study baseline) and at week 10 ]
    Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum testosterone levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

  8. Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC in accordance with BDNF rs6265 gene polymorphism and gender [ Time Frame: At disease onset (study baseline) and at week 10 ]
    Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC divided into BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, females) at study baseline and week 10

  9. Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of testosterone/cortisol ratio in EAD, IAD, PS and HC [ Time Frame: At disease onset (study baseline) and at week 10 ]
    Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of testosterone/cortisol ratio in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of testosterone/cortisol ratio in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

  10. Correlation analysis of studied parameters in dermatological patients and HC [ Time Frame: At disease onset (study baseline) and week 10 ]
    Correlation analysis of dermatological, psychological and biochemical parameters in EAD, IAD and PS patients, and HC divided into groups in accordance with BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, femaes)


Biospecimen Retention:   Samples With DNA
DNA are extracted using Wizard Genomic DNA purification (Promega, US, A1120) and measured using NanoDrop 8000 (Thermo Scientific, US). Amplification of rs6265 allelic variants will be performed in a Stratagene Mx 3000P (Agilent Technologies, US) with custom primers (TCCTCATCCAACAGCTCTTCTATCA [C/T] GTGTTCGAAAGTGTCAGCCAATGAT; TaqMan SNP Genotyping Assay, ThermoFisher Scientific, US).


Information from the National Library of Medicine

Choosing to participate in a study is an important personal decision. Talk with your doctor and family members or friends about deciding to join a study. To learn more about this study, you or your doctor may contact the study research staff using the contacts provided below. For general information, Learn About Clinical Studies.


Layout table for eligibility information
Ages Eligible for Study:   18 Years and older   (Adult, Older Adult)
Sexes Eligible for Study:   All
Gender Based Eligibility:   Yes
Gender Eligibility Description:   AD and PS patients will be divided by gender for assessment of clinical, psychological and biochemical parameters and subsequent comparison with appropriate HC
Accepts Healthy Volunteers:   Yes
Sampling Method:   Probability Sample
Study Population
Atopic dermatitis and psorisis patiens older than 18 years with mild and moderate forms of disease, and healthy volunteers
Criteria

Inclusion Criteria:

  • mild and moderate atopic dermatitis and psoriasis
  • age of patients over 18 years
  • no systemic therapy (glucocorticosteroids, immunosuppressants and psychotropic drugs) within the month prior the study and blood sampling
  • no history of mental or other dermatological disorders
  • no unstable non-dermatological medical conditions
  • good general physical health
  • no pregnancy

Exclusion Criteria:

  • pregnancy
  • unstable non-dermatological medical conditions
  • severe forms of AD and PS

Information from the National Library of Medicine

To learn more about this study, you or your doctor may contact the study research staff using the contact information provided by the sponsor.

Please refer to this study by its ClinicalTrials.gov identifier (NCT number): NCT03831646


Contacts
Layout table for location contacts
Contact: Tatyana Vinnik, MD,PhD +77017687691 tatyanavinni15@gmail.com
Contact: Anatoly Kreinin, MD,PhD +972 52 390 3337 kranata@gmail.com

Locations
Layout table for location information
Kazakhstan
Tatyana Vinnik Recruiting
Astana, Kazakhstan, 000010
Contact: Tatyana Vinnik, PhD    +77017687691    tatyanavinnik15@gmail.com   
Sponsors and Collaborators
Astana Medical University
Ariel University
Tirat Carmel Mental Health Center
Medical Centre Hospital of the President’s Affairs Administration, Republic of Kazakhstan
Investigators
Layout table for investigator information
Principal Investigator: Tatyana Vinnik, MD, PhD Astana Medical University

Additional Information:
Layout table for additonal information
Responsible Party: Tatyana Vinnik, Assistant Professor, Astana Medical University
ClinicalTrials.gov Identifier: NCT03831646     History of Changes
Other Study ID Numbers: 4
First Posted: February 6, 2019    Key Record Dates
Last Update Posted: February 6, 2019
Last Verified: February 2019
Individual Participant Data (IPD) Sharing Statement:
Plan to Share IPD: No
Plan Description: Confidentiality will be assured by means of a number coding system, and all completed research forms will be stored in secure areas

Layout table for additional information
Studies a U.S. FDA-regulated Drug Product: No
Studies a U.S. FDA-regulated Device Product: No

Keywords provided by Tatyana Vinnik, Astana Medical University:
atopic dermatitis
psoriasis
brain-derived neurotrophic factor
depression
gender
immunoglobulin E
cortisol
testosterone

Additional relevant MeSH terms:
Layout table for MeSH terms
Psoriasis
Dermatitis
Dermatitis, Atopic
Eczema
Skin Diseases, Papulosquamous
Skin Diseases
Skin Diseases, Genetic
Genetic Diseases, Inborn
Skin Diseases, Eczematous
Hypersensitivity, Immediate
Hypersensitivity
Immune System Diseases
Dermatologic Agents